I can't think why anyone should want this, but this produces the time as a PostScript-file
It was this message in alt.fan.douglas-adams:
From: till@tillwe.de (Till Westermayer)
Newsgroups: alt.fan.douglas-adams
Subject: Re: The hitchhikers guide to not pissing people off in afda
Date: 05 Jun 2001 23:17:00 +0200
[05 Jun 01: Roy (fohat@capu.net) wrote something]
>right, right, I'll just need to go and get some beakers and
>tubing, and in the meantime I'll need to collect a DNA sample from
>the froup.
>Please insert your DNA sample in this container <~~>
Here - I've collected this DNA sample out of "Mostly harmless":
"aggctgcagtctagcggatttagcgagctgagggcctagcgtagcgtagggcaaacgatcgatcgatcgaggc
ctagc" Does it fit?
till (the next time)
--
This isn't a sig - did you know? (Hey, I finally found out how to
rotate my sigs! Yippie!)
... Till We *) http://www.westermayer.de/till/index.htm
that inspired me to write this simple program, and
later on to this page.
And also some BASIC-versions.
If you want to play with Lego: This generates LDraw-files.