De tijd in PostScript formaat

Ik heb zelf geen waarom iemand hier behoefte aan zou hebben, maar dit programma produceert de huidige tijd in PostScript-formaat.

De broncode

klok2ps.exe

DNA

Het was dit bericht in alt.fan.douglas-adams:

From: till@tillwe.de (Till Westermayer)
Newsgroups: alt.fan.douglas-adams
Subject: Re: The hitchhikers guide to not pissing people off in afda
Date: 05 Jun 2001 23:17:00 +0200

[05 Jun 01: Roy (fohat@capu.net) wrote something]

>right, right, I'll just need to go and get some beakers and
>tubing, and in the meantime I'll need to collect a DNA sample from
>the froup.

>Please insert your DNA sample in this container <~~>

Here - I've collected this DNA sample out of "Mostly harmless":  
"aggctgcagtctagcggatttagcgagctgagggcctagcgtagcgtagggcaaacgatcgatcgatcgaggc 
ctagc" Does it fit?

till (the next time)

-- 
        This isn't a sig - did you know? (Hey, I finally found out how to
        rotate my sigs! Yippie!)

  ... Till We *)                http://www.westermayer.de/till/index.htm

dat mij tot dit programmaatje (C) inspireerde, en naderhand tot deze pagina.
En daarnaast wat Basic-versie.

Voor wie met Lego wil werken: Dit genereert LDraw-files.